IB Biology Practical Investigations/The Chemistry of Life/Protein Synthesis Running Dictation

From Wikibooks, open books for an open world
< IB Biology Practical Investigations‎ | The Chemistry of Life
Jump to: navigation, search

PROTEIN SYNTHESIS RUNNING DICTATION[edit]

TEACHING OBJECTIVE:

  • To introduce/ consolidate the processes of transcription/ translation (at Standard Level) through student modelling and a competition. Success depends on students' understanding of the topic.



TASK OUTCOMES: By the end of this activity, students will be able to:

  • Transcribe and translate a 10-amino-acid polypeptide
  • work as a group to build a model of a polypeptide whilst acting as parts of the process.
  • Describe the effects of errors (e.g. base substitution) on the the final product


TIME REQUIRED:

  • 15 minutes if used for consolidation, up to 30 if used for teaching



INTRODUCTION:


In this activity, students will work in teams of three to transcribe a DNA sequence and translate it into a polypeptide. This challenge is straightforward if explained clearly but can be a headache if not. It can be used either as a plenary to consolidate SL protein synthesis, or as a challenging teaching task.



MATERIALS AND EQUIPMENT:

Instructions Image. remove the answers first!

(per group of three)

  • LEGO blocks, beads or similar (5 colours, 6 blocks of each)
  • genetic code image (included here) - 1 per group
  • instructions image, projected on whiteboard (cut off DNA, mRNA and A.A. sequences)
  • pen and scrap paper
  • poster made up of the DNA sequence, no spaces between triplets.
  • correct answer written down or photographed for checking


OTHER RESOURCES NEEDED:

  • text book or study guide


INSTRUCTIONS:

Genetic Code
  • split class into groups of three
  • put up a large poster of the DNA sequence (unspaced) in the corridor (TCTCAACAATACCGAGCCCTTGCGTCTGCTGCACAATCCACTGCACGA)
  • set up one table per group, with a set of blocks inside the classroom
  • assign roles for each player:
    • player 1 = RNA POLYMERASE
      • job: read poster, transcribe to mRNA codons, run into classroom, hand off to player 2.
    • player 2 = tRNA
      • job: translate codons into amino acids and shout out the sequence. Needs genetic code sheet.
    • player 3 = LARGE RIBOSOMAL SUBUNIT
      • job: listen to the sequence, grab the correct blocks and put them in the right order.
  • RULES:
    • player 1 may not help player 2, player 2 may not help player 3
    • first team to finish must shout stop
    • teams may not 'edit' their final model
  • SCORING:
    • first to finish = 100 points
    • second = 90 points
    • third = 80 points and so on...
    • each error in the amino acid sequence has a penalty of -10 points.
    • highest scoring team wins (may not necessarily be the fastest)


  • If this task is used for teaching for the first time, texts will be required for the group and they should plan their strategy together and make sure all members understand before they start running about.


  • THE SOLUTION:
    • the DNA sequence is TCTCAACAATACCGAGCCCTTGCGTCTGCTGCACAATCCACTGCACGA.
    • this is 48 bases long, but only codes for 10 amino acids.
    • transcription MUST begin at the 'START' codon: TCTCAACAA TACCGAGCCCTTGCGTCTGCTGCACAATCCACT GCACGA
    • it must end at the 'STOP' codon (ACT)
    • the mRNA sequence is: AUG - GCU - CGG - GAA - GCG - AGA - CGA - CGU - GUU - AGG - UGA
    • this gives the amino acids: MET - ALA - ARG - GLU - ALA - ARG - ARG - ARG - VAL - ARG - STOP


SAFETY/ RISK ASSESSMENT

  • Clear any obstacle out of the way
  • Maintain order and force students to walk if necessary




IDEAS FOR FURTHER INVESTIGATION

  • Put up an alternate version of the DNA sequence for one team: TCTCAACAATACCGAGCCCATGCGTCTGCTGCACAATCCACTGCACGA
    • In this version, the fourth triplet in the gene has been changed from 'CTT' to CAT
    • This represents a base substitution mutation, and the resulting amino acid will change from 'glu' to 'val'
    • Use this mutation to introduce/ discuss base substituion mutations, with reference to sickle cell anaemia.
    • Can the students spot the source/outcome of the error by themselves?
  • Where groups forgot to begin at the 'START/MET' codon, discuss this error
  • With HL students, discuss the effects of base deletion or frame-shift mutations. These may be apparent if they made an error caused by deletion or insertion of a base in the mRNA.



SOURCES AND REFERENCES:

  • The genetic code image is from an unknown source - please correct if known
  • The instructions image was produced by Steve Taylor